Note:

• siRNA sequence: Please type in given area (fastq format) as followed. Note: sequence order of sense strand and anti-sense strand are both 5'-3'.
  >siRNA1_Name
  GCAGCACGACUUCUUCAAGUU
  GCAGCACGACUUCUUCAAGUU
• Chemical modifications: Each modifications is represented by SMILE which is a molecular fingerprint.
  For example, if there are two modification (S1, S2) and one modification (S3) on the sense and antisense strand of siRNA, resepctively. S1 modification has sited in the 1,3,5 position and S1 modification has sited in the 2,4,7 of sense strand. S3 modification has sited in the 1,4,5,7 of antisense strand. We could have content as followed:
  S1;S2*S3__1,3,5;2,4,7*1,4,5,7
• The reference of SMILEs list: Unique modifications from siRNAmod.